BidHits

Tga e-Tenders

Tender alerts, smarter matches, regional filters and links to documents or official pages

90% recommend BidHits (1097 real users, 18/09/2026). Methodology

Last updated on 06/28/2026.

06/16/2026 - INDIA

Indian Council Of Agricultural Research ( Icar)

Cgg aag act tgc tct tct ta, gtt att tgg tgc ata taa tac ata, tca gat ccc aga aga ctt gtt aat, atg tat ata tgt gta tga atg tag tac tcg, gat ctg gat gtt cat aag g, gaggtggaagagtacggttgtg, cctcacaatttcagtcaacatcgt, gccacctcctagatgtggtcata, gtccatccaggtgtttcacg, ggcatagtattccctagaagagagataac, tgttgattcttagaatggtaaatcacag, ttgaaaatcacatgtatacatatggctt

Tender Close Date:

Get to more relevant tenders faster!
Start your free 14-day trial to see all results and access the tender documents.

From portal checking to useful alerts in 3 steps

  1. Tell us what you sell

    Add keywords for your products or services. Smart Search helps broaden matches without making you search every portal manually.

  2. Start the trial and receive alerts

    Use the 14-day free trial and get alerts with links to documents or to the official process page.

  3. Refine what matters

    Adjust keywords, states/UTs, delivery times and email style. Use filters and map view to focus on the tenders worth acting on.

User testimonials
We selected the most helpful reviews from real users. Order may change periodically.
Very good and accurate information about the tenders: consistent and precise.
G. R. Ortiz
It encompasses all portals in one place.
G. Ferrea
All tenders related to our product are captured by you and sent to us. In my opinion, it’s perfect—broad coverage and easy searches across the tender documents.
R. M. Ferreira
Excellent information. Just what I was looking for.
L. H. Borrelli
Fast, flexible, and simple.
E. Disruptivas
The tool is truly effective at scanning tender documents, efficiently delivering bids.
G. D. Reis
They notify me promptly when a contest is published.
L. Salazar
I like the way they provide information with the greatest possible accuracy. I love that.
M. A. Neil
I am very satisfied; it's a very useful tool.
J. S. Garcia
You see a lot of tenders; you get emails with the alerts.
M. Camarasa
I quickly find the tenders that interest me.
S. Roque
The idea of ​​using a keyword and sending the information by email is very good.
U. Solutions
Very good and very clear information.
D. Ramos

How BidHits helps with e-tendering

For teams and integrations

Integrate tenders into your workflow via the Tenders API and receive data in JSON or XML.
View API documentation

Frequently asked questions

BidHits helps businesses find relevant Indian public tenders faster. We monitor official sources, show results on the site and by email, and help you open documents or the official process page.

Enter your email and activate the trial. For 14 days you can use the features, test your keywords and check the quality of matches. If you do not subscribe at /subscription.php, access becomes limited and you will not be charged automatically.

Add keywords for what you sell, start the trial, and receive matching opportunities by email. After signup, you can adjust states/UTs, delivery times and email style in Settings.

Whenever possible, yes. Some official portals require login, captcha or other access steps. In those cases, we point you to the official process page so you can continue from the correct source.

Yes. In the tenders panel you can filter by state/UT, procurement method, dates and value ranges. You can also save preferences for future alerts and searches.

Yes. You can favourite tenders, add private notes, remove what does not fit and use comments to keep your pipeline organised.

Smart Search can make mistakes, so your keywords still matter. Add specific terms, remove off-topic words and adjust your settings to improve future alerts.

Yes. You can query tenders via API. Documentation is available at /api_integration.php. It is useful for CRM, BI and internal workflows.

In Settings you can pause alerts or adjust delivery times. If you want to delete your account, just contact us. During the free trial there is no auto-charge.

We monitor major official sources daily at central, state and local levels. New tenders are added as soon as they are collected from the source.

Plans start at ₹ 3,900.00 per month, with options for different business needs and billing terms. Start with a free trial and evaluate the results before subscribing, with no automatic billing.

See how it works

Start free trial

Search a term, enable alerts, open documents or official pages, and filter by state/UT, method and value.

Transcript
Welcome to BidHits. Finding public tenders and bids is important. But what really matters is quickly identifying the opportunities that match what your company sells. To get started, enter a few keywords that describe your products or services. BidHits shows relevant opportunities, highlights your keywords, and organizes everything by date. Smart search is already enabled and uses artificial intelligence to expand your results, even when the tender uses different words from the ones you searched for. For each opportunity, you can view a summary, access documents, mark it as a favorite, add private notes, remove what is not relevant, or view it on the map. You can also use filters, run searches, and explore the day's opportunities directly on the map. Start using BidHits now. It's fast, practical, and you can try it for free.
AI Assistant
Ask me about the tender...
Loading summary...