BidHits
BidHits

Tga e-Tenders

Tender alerts, smarter matches, regional filters and links to documents or official pages

See also

90% recommend BidHits (1114 real users, 05/11/2026). Methodology

Last updated on 06/28/2026.

06/16/2026 - INDIA

Indian Council Of Agricultural Research ( Icar)

Cgg aag act tgc tct tct ta, gtt att tgg tgc ata taa tac ata, tca gat ccc aga aga ctt gtt aat, atg tat ata tgt gta tga atg tag tac tcg, gat ctg gat gtt cat aag g, gaggtggaagagtacggttgtg, cctcacaatttcagtcaacatcgt, gccacctcctagatgtggtcata, gtccatccaggtgtttcacg, ggcatagtattccctagaagagagataac, tgttgattcttagaatggtaaatcacag, ttgaaaatcacatgtatacatatggctt

Tender Close Date:

Documents
Get to more relevant tenders faster!
Start your free 14-day trial to see all results and access the tender documents.
Start free trial

From portal checking to useful alerts in 3 steps

  1. Tell us what you sell

    Add keywords for your products or services. Smart Search helps broaden matches without making you search every portal manually.

  2. Start the trial and receive alerts

    Use the 14-day free trial and get alerts with links to documents or to the official process page.

  3. Refine what matters

    Adjust keywords, states/UTs, delivery times and email style. Use filters and map view to focus on the tenders worth acting on.

User testimonials
We selected the most helpful reviews from real users. Order may change periodically.
It encompasses all portals in one place.
G. Ferrea
I consistently received notifications about tenders within the specific segment I chose to monitor. The system simplifies processes that used to be complex, offering a navigation experience that is easy, fast, and modern.
G. P. da S. E. Guimaraes
Excellent. More searches and many advantages.
R. Lopez
Everything is perfect. They are a great help in finding tenders relevant to our field of work. I really appreciate that the tenders are sent directly to my email; it’s a huge help in identifying where I can contribute and what I can do.
Oto
I closed deals thanks to the information gathered by the search tool. There’s no need to research across multiple media outlets.
J. Comunale
Very good and accurate information about the tenders: consistent and precise.
G. R. Ortiz
I like the way they provide information with the greatest possible accuracy. I love that.
M. A. Neil
The tool is truly effective at scanning tender documents, efficiently delivering bids.
G. D. Reis
Excellent information. Just what I was looking for.
L. H. Borrelli
The tenders appear appropriately based on my interests.
V. Niembro
It is complete and optimal, it improves my time.
R. de L. Cruz
You see a lot of tenders; you get emails with the alerts.
M. Camarasa
Smart search helped discover tenders I hadn't even imagined receiving notifications for.
M. F. Cortez
Start free trial

How BidHits helps with e-tendering

Start free trial

For teams and integrations

Integrate tenders into your workflow via the Tenders API and receive data in JSON or XML.
View API documentation

Frequently asked questions

BidHits helps businesses find relevant Indian public tenders faster. We monitor official sources, show results on the site and by email, and help you open documents or the official process page.

Enter your email and activate the trial. For 14 days you can use the features, test your keywords and check the quality of matches. If you do not subscribe at /subscription.php, access becomes limited and you will not be charged automatically.

Add keywords for what you sell, start the trial, and receive matching opportunities by email. After signup, you can adjust states/UTs, delivery times and email style in Settings.

Whenever possible, yes. Some official portals require login, captcha or other access steps. In those cases, we point you to the official process page so you can continue from the correct source.

Yes. In the tenders panel you can filter by state/UT, procurement method, dates and value ranges. You can also save preferences for future alerts and searches.

Yes. You can favourite tenders, add private notes, remove what does not fit and use comments to keep your pipeline organised.

Smart Search can make mistakes, so your keywords still matter. Add specific terms, remove off-topic words and adjust your settings to improve future alerts.

Yes. You can query tenders via API. Documentation is available at /api_integration.php. It is useful for CRM, BI and internal workflows.

In Settings you can pause alerts or adjust delivery times. If you want to delete your account, just contact us. During the free trial there is no auto-charge.

We monitor major official sources daily at central, state and local levels. New tenders are added as soon as they are collected from the source.

Plans start at ₹ 1,825.00 per month, with options for different business needs and billing terms. Start with a free trial and evaluate the results before subscribing, with no automatic billing.
Start free trial

See how it works

Start free trial

Search a term, enable alerts, open documents or official pages, and filter by state/UT, method and value.

Transcript
Welcome to BidHits. Finding public tenders and bids is important. But what really matters is quickly identifying the opportunities that match what your company sells. To get started, enter a few keywords that describe your products or services. BidHits shows relevant opportunities, highlights your keywords, and organizes everything by date. Smart search is already enabled and uses artificial intelligence to expand your results, even when the tender uses different words from the ones you searched for. For each opportunity, you can view a summary, access documents, mark it as a favorite, add private notes, remove what is not relevant, or view it on the map. You can also use filters, run searches, and explore the day's opportunities directly on the map. Start using BidHits now. It's fast, practical, and you can try it for free.
AI Assistant
Ask me about the tender...
Loading summary...